Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G53590 74 / 8e-18 SAUR-like auxin-responsive protein family (.1) AT3G61900 73 / 1e-17 SAUR-like auxin-responsive protein family (.1) AT4G00880 71 / 5e-17 SAUR-like auxin-responsive protein family (.1) AT2G46690 66 / 4e-15 SAUR-like auxin-responsive protein family (.1) AT3G43120 66 / 1e-14 SAUR-like auxin-responsive protein family (.1) AT5G20810 65 / 2e-14 SAUR-like auxin-responsive protein family (.1.2) AT4G34800 62 / 6e-14 SAUR-like auxin-responsive protein family (.1) AT3G60690 64 / 1e-13 SAUR-like auxin-responsive protein family (.1) AT4G34780 62 / 1e-13 SAUR-like auxin-responsive protein family (.1) AT4G22620 62 / 2e-13 SAUR-like auxin-responsive protein family (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G306300 [exp] 156 / 6e-51 AT5G53590 75 / 2e-18 SAUR-like auxin-responsive protein family (.1) Potri.012G023400 [exp] 73 / 8e-18 AT2G46690 125 / 4e-38 SAUR-like auxin-responsive protein family (.1) Potri.002G176400 [exp] 71 / 3e-17 AT2G46690 145 / 2e-46 SAUR-like auxin-responsive protein family (.1) Potri.014G103300 [exp] 71 / 5e-17 AT2G46690 152 / 2e-49 SAUR-like auxin-responsive protein family (.1) Potri.015G006800 [exp] 67 / 1e-15 AT2G46690 128 / 2e-39 SAUR-like auxin-responsive protein family (.1) Potri.004G165300 [exp] 64 / 2e-14 AT4G38840 130 / 6e-41 SAUR-like auxin-responsive protein family (.1) Potri.009G127400 [exp] 64 / 2e-14 AT4G34770 111 / 3e-33 SAUR-like auxin-responsive protein family (.1) Potri.009G126900 [exp] 63 / 2e-14 AT4G38840 131 / 1e-41 SAUR-like auxin-responsive protein family (.1) Potri.004G165450 [exp] 63 / 4e-14 AT4G38840 129 / 2e-40 SAUR-like auxin-responsive protein family (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10005781 [exp] 122 / 7e-37 AT5G53590 70 / 8e-16 SAUR-like auxin-responsive protein family (.1) Lus10006820 [exp] 119 / 6e-36 AT5G53590 69 / 5e-16 SAUR-like auxin-responsive protein family (.1) Lus10010110 [exp] 66 / 5e-15 AT2G46690 124 / 1e-37 SAUR-like auxin-responsive protein family (.1) Lus10007561 [exp] 62 / 1e-13 AT4G34810 125 / 1e-38 SAUR-like auxin-responsive protein family (.1) Lus10034888 [exp] 62 / 4e-13 AT5G20810 210 / 2e-70 SAUR-like auxin-responsive protein family (.1.2) Lus10010713 [exp] 60 / 8e-13 AT4G38840 111 / 2e-33 SAUR-like auxin-responsive protein family (.1) Lus10012184 [exp] 60 / 8e-13 AT4G34810 125 / 9e-39 SAUR-like auxin-responsive protein family (.1) Lus10032949 [exp] 61 / 1e-12 AT4G00880 104 / 9e-30 SAUR-like auxin-responsive protein family (.1) Lus10027317 [exp] 59 / 2e-12 AT5G18030 119 / 1e-36 SAUR-like auxin-responsive protein family (.1) Lus10039020 [exp] 59 / 2e-12 AT5G18020 118 / 2e-36 SAUR-like auxin-responsive protein family (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description PF02519 [poplar] [flax] Auxin_inducible Auxin responsive protein
Representative CDS sequence Show only first row Show all	>Potri.019G002201.1 pacid=42773971 polypeptide=Potri.019G002201.1.p locus=Potri.019G002201 ID=Potri.019G002201.1.v4.1 annot-version=v4.1 ATGAGCAATACGCAGGAAGATAAGAAGAAGGTAAAGAAAGGATGGCTTGCAGTTCGAGTTGGTTTAGAGGAAGAAGATGGTGGGTTTCAGAGATTTGTGA TTCCAATTTCGTATCTATACCACCCTCTTTTCAAGCGACTTTTAGAGAAAGCTCATGAAGTTTACGGCTACCACACTACAGGTCCGCTATGGCTACCGTG TTCCGTTGATGATTTTCTTCATCTCCGGTGGAGGATTGAAAGAGAGTCTAGCCATCACAGCCACCACAGTAACCTTCATCAGCACCTTCCTAGCTCCTTG TCTTTTCACTCTTGTTGA
AA sequence Show only first row Show all	>Potri.019G002201.1 pacid=42773971 polypeptide=Potri.019G002201.1.p locus=Potri.019G002201 ID=Potri.019G002201.1.v4.1 annot-version=v4.1 MSNTQEDKKKVKKGWLAVRVGLEEEDGGFQRFVIPISYLYHPLFKRLLEKAHEVYGYHTTGPLWLPCSVDDFLHLRWRIERESSHHSHHSNLHQHLPSSL SFHSC

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G53590			SAUR-like auxin-responsive pro...		Potri.019G002201 [exp]	0	1
AT5G26340		ATSTP13, MSS1, ...	SUGAR TRANSPORT PROTEIN 13, Ma...		Potri.008G151100 [exp]	2.44	0.7542
AT3G43740			Leucine-rich repeat (LRR) fami...		Potri.009G090700 [exp]	2.64	0.7888
AT1G07250		UGT71C4	UDP-glucosyl transferase 71C4 ...		Potri.014G026301 [exp]	30.88	0.7039
AT4G26470			Calcium-binding EF-hand family...		Potri.001G471100 [exp]	31.04	0.7211
AT3G53670			unknown protein		Potri.006G082100 [exp]	34.46	0.6867
AT4G18880	HSF	AT-HSFA4A ,HSF ...	ARABIDOPSIS THALIANA HEAT SHOC...		Potri.004G062300 [exp]	35.91	0.7175
AT4G25433			peptidoglycan-binding LysM dom...		Potri.014G077900 [exp]	36.12	0.6754
AT3G60640		ATG8G	AUTOPHAGY 8G, Ubiquitin-like s...		Potri.002G144600 [exp]	39.79	0.6341
AT1G11700			Protein of unknown function, D...		Potri.011G003300 [exp]	41.13	0.7126
AT1G75180			Erythronate-4-phosphate dehydr...		Potri.002G260900 [exp]	46.90	0.6641

Compare expression of checked genes

Potri.019G002201 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.