Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G71950 130 / 8e-40 Proteinase inhibitor, propeptide (.1) AT4G10550 71 / 4e-15 Subtilase family protein (.1.2.3) AT1G32950 67 / 9e-14 Subtilase family protein (.1) AT5G11940 67 / 9e-14 Subtilase family protein (.1) AT4G10530 66 / 2e-13 Subtilase family protein (.1) AT4G10520 66 / 2e-13 Subtilase family protein (.1) AT1G66220 66 / 4e-13 Subtilase family protein (.1) AT1G32960 64 / 1e-12 ATSBT3.3 Subtilase family protein (.1) AT4G10540 64 / 2e-12 Subtilase family protein (.1) AT4G21640 62 / 7e-12 Subtilase family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.013G112800 [exp] 190 / 1e-63 AT1G71950 129 / 2e-39 Proteinase inhibitor, propeptide (.1) Potri.011G150900 [exp] 77 / 4e-17 AT1G32960 744 / 0.0 Subtilase family protein (.1) Potri.001G450600 [exp] 71 / 5e-15 AT1G32960 772 / 0.0 Subtilase family protein (.1) Potri.001G002200 [exp] 71 / 6e-15 AT4G26330 891 / 0.0 UNFERTILIZED EMBRYO SAC 17, Subtilisin-like serine endopeptidase family protein (.1) Potri.001G450401 [exp] 71 / 6e-15 AT4G10550 938 / 0.0 Subtilase family protein (.1.2.3) Potri.011G151200 [exp] 70 / 9e-15 AT1G32960 906 / 0.0 Subtilase family protein (.1) Potri.004G161400 [exp] 68 / 6e-14 AT4G10550 659 / 0.0 Subtilase family protein (.1.2.3) Potri.012G133200 [exp] 65 / 5e-13 AT5G59090 646 / 0.0 subtilase 4.12 (.1.2.3) Potri.010G196800 [exp] 64 / 1e-12 AT5G59100 599 / 0.0 Subtilisin-like serine endopeptidase family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10038252 [exp] 140 / 1e-43 AT1G71950 127 / 7e-39 Proteinase inhibitor, propeptide (.1) Lus10025848 [exp] 110 / 2e-32 AT1G71950 97 / 5e-27 Proteinase inhibitor, propeptide (.1) Lus10002964 [exp] 79 / 6e-18 AT5G59100 624 / 0.0 Subtilisin-like serine endopeptidase family protein (.1) Lus10042555 [exp] 78 / 1e-17 AT5G59100 603 / 0.0 Subtilisin-like serine endopeptidase family protein (.1) Lus10009867 [exp] 63 / 3e-12 AT5G59190 629 / 0.0 subtilase family protein (.1) Lus10032424 [exp] 59 / 9e-12 AT2G04160 123 / 3e-33 AUXIN-INDUCED IN ROOT CULTURES 3, Subtilisin-like serine endopeptidase family protein (.1) Lus10013154 [exp] 61 / 2e-11 AT3G14067 915 / 0.0 Subtilase family protein (.1) Lus10039087 [exp] 58 / 2e-10 AT2G04160 810 / 0.0 AUXIN-INDUCED IN ROOT CULTURES 3, Subtilisin-like serine endopeptidase family protein (.1) Lus10023048 [exp] 58 / 2e-10 AT5G59810 762 / 0.0 Subtilase family protein (.1) Lus10040251 [exp] 57 / 2e-10 AT5G59190 438 / 6e-143 subtilase family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0570 [poplar] [flax] PPP-I PF05922 [poplar] [flax] Inhibitor_I9 Peptidase inhibitor I9
Representative CDS sequence Show only first row Show all	>Potri.019G083300.1 pacid=42773637 polypeptide=Potri.019G083300.1.p locus=Potri.019G083300 ID=Potri.019G083300.1.v4.1 annot-version=v4.1 ATGAAGCAGAGCTCAAAATCCAATATGCACAGAAGAACCAAATTTCCCTTCTCGTTCTCATCATCATCACCGTTGATTTTGTTGTTGGCTTTGATCTTTG TAATCAGAATGGCCGAGTCTGTTCCTTCAACGGCTGATTCATCATCAACAGCATCGGTTCAGATTGTCTATACCGAGAGACCTCAGGACGAGGAGCCTGA GGCTTACCATATCCGAACCCTCGCCTCTGTTCTTGGCAGCGAGGATGCTGCAAAGGAGGCTTTGCTTTATAGTTATAAGGCAGCAGCGAGTGGATTCTCT GCCAAGCTGACACCACAACAAGTTGAACAAATCTCAAAACTTCCAGGTGTTCTTCAGGTTGTCCCCAGCAAGAAACTTCAGCTGCATACAGGACCTGGGA TTGGGAGGCTGCATTAA
AA sequence Show only first row Show all	>Potri.019G083300.1 pacid=42773637 polypeptide=Potri.019G083300.1.p locus=Potri.019G083300 ID=Potri.019G083300.1.v4.1 annot-version=v4.1 MKQSSKSNMHRRTKFPFSFSSSSPLILLLALIFVIRMAESVPSTADSSSTASVQIVYTERPQDEEPEAYHIRTLASVLGSEDAAKEALLYSYKAAASGFS AKLTPQQVEQISKLPGVLQVVPSKKLQLHTGPGIGRLH

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G71950			Proteinase inhibitor, propepti...		Potri.019G083300 [exp]	0	1
AT1G71950			Proteinase inhibitor, propepti...		Potri.013G112800 [exp]	1.00	0.8180
AT5G03460			unknown protein		Potri.006G122600 [exp]	2.44	0.7776
AT2G20230			Tetraspanin family protein (.1...		Potri.002G253500 [exp]	5.29	0.7902
AT1G77370			Glutaredoxin family protein (....		Potri.007G017300 [exp]	9.89	0.7711	PtrcGrx_C3
AT5G64180			unknown protein		Potri.012G022200 [exp]	12.36	0.7885
AT3G59600		NRPE8B, NRPD8B,...	RNA polymerase Rpb8 (.1)		Potri.013G120500 [exp]	12.64	0.7381	Pt-ATRPABC16.2
AT3G52560		MMZ4 ,UEV1D ,UE...	MMS2 ZWEI HOMOLOGUE 4, ubiquit...		Potri.006G205700 [exp]	19.13	0.6905
AT5G15220			Ribosomal protein L27 family p...		Potri.003G009500 [exp]	20.44	0.7542
AT1G60680		AGD2	NAD(P)-linked oxidoreductase s...		Potri.008G158300 [exp]	23.51	0.6761
AT1G26550			FKBP-like peptidyl-prolyl cis-...		Potri.008G089900 [exp]	25.45	0.7522

Compare expression of checked genes

Potri.019G083300 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.