Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G72860 54 / 6e-10 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT1G17600 52 / 3e-09 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT5G48770 52 / 4e-09 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT1G72890 51 / 8e-09 Disease resistance protein (TIR-NBS class) (.1), Disease resistance protein (TIR-NBS class) (.2) AT5G40100 49 / 2e-08 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT1G17615 49 / 3e-08 Disease resistance protein (TIR-NBS class) (.1) AT1G72840 49 / 4e-08 Disease resistance protein (TIR-NBS-LRR class) (.1), Disease resistance protein (TIR-NBS-LRR class) (.2) AT5G36930 47 / 2e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) AT4G09430 47 / 2e-07 Disease resistance protein (TIR-NBS-LRR class) family (.1) AT1G27170 45 / 8e-07 transmembrane receptors;ATP binding (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.019G019053 [exp] 161 / 8e-48 AT5G36930 655 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.003G014200 [exp] 161 / 1e-47 AT5G36930 673 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.019G016425 [exp] 157 / 2e-46 AT5G36930 650 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.019G017082 [exp] 148 / 5e-43 AT5G36930 638 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.007G143100 [exp] 133 / 7e-40 AT5G36930 234 / 1e-69 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.T001933 [exp] 136 / 5e-39 AT5G36930 617 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.007G143300 [exp] 129 / 2e-36 AT5G36930 519 / 2e-162 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.T011750 [exp] 127 / 1e-35 AT5G36930 551 / 2e-176 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Potri.T002200 [exp] 125 / 4e-35 AT5G36930 617 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011741 [exp] 63 / 4e-13 AT5G36930 540 / 4e-172 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10032101 [exp] 60 / 4e-12 AT1G27170 270 / 6e-80 transmembrane receptors;ATP binding (.1.2) Lus10009384 [exp] 56 / 8e-12 AT1G72890 63 / 4e-13 Disease resistance protein (TIR-NBS class) (.1), Disease resistance protein (TIR-NBS class) (.2) Lus10018616 [exp] 59 / 2e-11 AT5G36930 578 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10005171 [exp] 58 / 3e-11 AT1G27170 576 / 0.0 transmembrane receptors;ATP binding (.1.2) Lus10014582 [exp] 57 / 3e-11 AT1G27170 186 / 9e-56 transmembrane receptors;ATP binding (.1.2) Lus10039850 [exp] 57 / 4e-11 AT5G36930 573 / 0.0 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10015453 [exp] 57 / 7e-11 AT1G27170 282 / 5e-84 transmembrane receptors;ATP binding (.1.2) Lus10020534 [exp] 56 / 1e-10 AT5G36930 414 / 1e-124 Disease resistance protein (TIR-NBS-LRR class) family (.1), Disease resistance protein (TIR-NBS-LRR class) family (.2) Lus10020536 [exp] 56 / 2e-10 AT1G27170 392 / 8e-118 transmembrane receptors;ATP binding (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0173 [poplar] [flax] STIR PF01582 [poplar] [flax] TIR TIR domain
Representative CDS sequence Show only first row Show all	>Potri.T002968.1 pacid=42782477 polypeptide=Potri.T002968.1.p locus=Potri.T002968 ID=Potri.T002968.1.v4.1 annot-version=v4.1 ATGCTGAAAGAAAAACGCAAGCAATCCAAAGATGAAGACAACGATTCATCCTCGCGAAAGAGAAGAAAAGCTGACCTCAGTAAGCCTGTCAGTTTTGTCT CCACAGCTGCCAGGACAGAGCCAGAGTCTTCTCGATCTAGACCAGAAGGGGCCTATGATGTCTTCTTGAGTTTTAGAGGAGAAGACACTCGCAAGACATT TACAGATCATCTCTACACTGCCTTAGTCCAAGCAGGAATCCACACTTTTTCGAGATGA
AA sequence Show only first row Show all	>Potri.T002968.1 pacid=42782477 polypeptide=Potri.T002968.1.p locus=Potri.T002968 ID=Potri.T002968.1.v4.1 annot-version=v4.1 MLKEKRKQSKDEDNDSSSRKRRKADLSKPVSFVSTAARTEPESSRSRPEGAYDVFLSFRGEDTRKTFTDHLYTALVQAGIHTFSR

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
					Potri.T002968 [exp]	0	1

Compare expression of checked genes

Potri.T002968 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.