Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G60900 88 / 2e-21 RLK1 receptor-like protein kinase 1 (.1) AT1G11340 53 / 5e-09 S-locus lectin protein kinase family protein (.1) AT3G12000 51 / 2e-08 S-locus related protein SLR1, putative (S1) (.1) AT1G11300 51 / 3e-08 protein serine/threonine kinases;protein kinases;ATP binding;sugar binding;kinases;carbohydrate binding (.1) AT1G11330 51 / 3e-08 S-locus lectin protein kinase family protein (.1.2) AT1G11410 47 / 7e-07 S-locus lectin protein kinase family protein (.1) AT1G65800 44 / 5e-06 ARK2 receptor kinase 2 (.1) AT1G11350 44 / 5e-06 SD1-13, RKS2, CBRLK1 CALMODULIN-BINDING RECEPTOR-LIKE PROTEIN KINASE, S-domain-1 13 (.1) AT4G21390 43 / 1e-05 B120 S-locus lectin protein kinase family protein (.1) AT1G61360 43 / 1e-05 S-locus lectin protein kinase family protein (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.T084300 [exp] 219 / 2e-68 AT5G60900 645 / 0.0 receptor-like protein kinase 1 (.1) Potri.T084401 [exp] 219 / 2e-68 AT5G60900 641 / 0.0 receptor-like protein kinase 1 (.1) Potri.001G014401 [exp] 117 / 3e-32 AT5G60900 280 / 2e-86 receptor-like protein kinase 1 (.1) Potri.001G014600 [exp] 116 / 3e-31 AT5G60900 666 / 0.0 receptor-like protein kinase 1 (.1) Potri.001G014100 [exp] 115 / 8e-31 AT5G60900 669 / 0.0 receptor-like protein kinase 1 (.1) Potri.T084500 [exp] 114 / 2e-30 AT5G60900 653 / 0.0 receptor-like protein kinase 1 (.1) Potri.003G212000 [exp] 113 / 4e-30 AT5G60900 655 / 0.0 receptor-like protein kinase 1 (.1) Potri.001G228200 [exp] 97 / 2e-24 AT5G60900 601 / 0.0 receptor-like protein kinase 1 (.1) Potri.001G228300 [exp] 90 / 4e-22 AT5G60900 534 / 4e-179 receptor-like protein kinase 1 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10031228 [exp] 99 / 5e-26 AT5G60900 161 / 2e-44 receptor-like protein kinase 1 (.1) Lus10031230 [exp] 100 / 8e-26 AT5G60900 388 / 4e-123 receptor-like protein kinase 1 (.1) Lus10004365 [exp] 89 / 1e-21 AT5G60900 545 / 0.0 receptor-like protein kinase 1 (.1) Lus10040160 [exp] 89 / 2e-21 AT5G60900 267 / 1e-88 receptor-like protein kinase 1 (.1) Lus10000422 [exp] 74 / 2e-17 AT5G60900 108 / 8e-28 receptor-like protein kinase 1 (.1) Lus10031231 [exp] 77 / 3e-17 AT5G60900 536 / 2e-180 receptor-like protein kinase 1 (.1) Lus10024195 [exp] 76 / 6e-17 AT5G60900 367 / 3e-114 receptor-like protein kinase 1 (.1) Lus10031805 [exp] 74 / 2e-16 AT5G60900 530 / 5e-178 receptor-like protein kinase 1 (.1) Lus10010992 [exp] 71 / 2e-15 AT5G60900 540 / 0.0 receptor-like protein kinase 1 (.1) Lus10001475 [exp] 69 / 5e-15 AT4G15920 244 / 4e-81 Nodulin MtN3 family protein (.1)
PFAM info
Representative CDS sequence Show only first row Show all	>Potri.T084450.1 pacid=42812785 polypeptide=Potri.T084450.1.p locus=Potri.T084450 ID=Potri.T084450.1.v4.1 annot-version=v4.1 ATGGTACTGTTACAGCTTATGGCTGTTGCTCAAACTAATGGAAGTATGCCCGTGGGTGCATTTATCACTGCAACTGATGATGCTCCTTCATGGCTTTCTT CCTCTGGAGAATTTGCTTTTGGATTTCAGCCCTTGGAATACAAGGATCATTTCTTGCTGTCTATTTGGTATGCCAAGATTCCTGAGAAGACCATAGTTTG GTATGCAAATGGAGATAATCCTGCACCAAGGGAGTCTAAGGTCGAGCTGAGGGGTGATAGTGGGCTGGTGCTTACTGATCCTCAAGGCAACCTAATATGG TCATCTGGTAGCCTTCAAGTGGAACGAAGCATAAAGGAGACGTTGGGCTGGAGGGATCTGATGTAA
AA sequence Show only first row Show all	>Potri.T084450.1 pacid=42812785 polypeptide=Potri.T084450.1.p locus=Potri.T084450 ID=Potri.T084450.1.v4.1 annot-version=v4.1 MVLLQLMAVAQTNGSMPVGAFITATDDAPSWLSSSGEFAFGFQPLEYKDHFLLSIWYAKIPEKTIVWYANGDNPAPRESKVELRGDSGLVLTDPQGNLIW SSGSLQVERSIKETLGWRDLM

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
					Potri.T084450 [exp]	0	1

Compare expression of checked genes

Potri.T084450 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.