Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G18372 154 / 9e-50 Small nuclear ribonucleoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042823 [exp] 238 / 7e-83 AT4G18372 154 / 7e-50 Small nuclear ribonucleoprotein family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.015G138100 [exp] 161 / 7e-53 AT4G18372 159 / 4e-52 Small nuclear ribonucleoprotein family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0527 [flax] [poplar] Sm-like PF01423 [flax] [poplar] LSM LSM domain
Representative CDS sequence Show only first row Show all	>Lus10000241 pacid=23154061 polypeptide=Lus10000241 locus=Lus10000241.g ID=Lus10000241.BGIv1.0 annot-version=v1.0 ATGGAGACTGGACCGGAAATGGACAAGCCGTCTGGTCGAGAAGATGGGAGCAGCGCAGAATGTAACAGCGAGGCAGGCATCTCAGATACTGTAGCTCGGG TGAAGAAACTGTTGTTTCGACAAATGCTGGTGGGAATAAAAGATGGGCGCTTTTTCATGGGGACGTTTCACTGCATGGATAAGCAAGGGAACATCATCCT TCAAGATGCTGTAGAATATCGTAGCACTCGACGGAATGCTCCTTCTCCGATGGAACAACGATGCCTTGGCCTGATTCTCATCCCTTTCTCCGCTAGAACA TCTTGTCACATTGAGTGTCAAATTGAGGAACAAATGTCTCTGCTGACGGTTCAAGAGTAG
AA sequence Show only first row Show all	>Lus10000241 pacid=23154061 polypeptide=Lus10000241 locus=Lus10000241.g ID=Lus10000241.BGIv1.0 annot-version=v1.0 METGPEMDKPSGREDGSSAECNSEAGISDTVARVKKLLFRQMLVGIKDGRFFMGTFHCMDKQGNIILQDAVEYRSTRRNAPSPMEQRCLGLILIPFSART SCHIECQIEEQMSLLTVQE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT4G18372			Small nuclear ribonucleoprotei...		Lus10000241 [exp]	0	1
AT2G20940			Protein of unknown function (D...		Lus10034474 [exp]	1.0	0.8220
AT5G51410			LUC7 N_terminus domain-contain...		Lus10038924 [exp]	2.4	0.7911
AT3G63390			unknown protein		Lus10024829 [exp]	4.0	0.7646
AT2G15910			CSL zinc finger domain-contain...		Lus10023841 [exp]	4.6	0.7862
AT5G41685			Mitochondrial outer membrane t...		Lus10001641 [exp]	5.0	0.7692
AT3G59520		ATRBL13	RHOMBOID-like protein 13 (.1)		Lus10005310 [exp]	6.5	0.7662
AT2G40780			Nucleic acid-binding, OB-fold-...		Lus10029014 [exp]	7.3	0.7316
AT3G59520		ATRBL13	RHOMBOID-like protein 13 (.1)		Lus10008156 [exp]	10.2	0.7651
AT5G04000			unknown protein		Lus10018038 [exp]	10.4	0.7754
AT5G55640			unknown protein		Lus10043162 [exp]	12.2	0.7561

Compare expression of checked genes

Lus10000241 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.