Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT4G16750 133 / 1e-40 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT2G35700 132 / 6e-40 AP2_ERF ATERF38 ERF family protein 38 (.1) AT3G60490 129 / 3e-38 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT2G44940 127 / 3e-37 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT3G16280 126 / 3e-37 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT5G11590 125 / 6e-37 AP2_ERF DREB3, TINY2 TINY2, Integrase-type DNA-binding superfamily protein (.1) AT5G25810 124 / 8e-37 AP2_ERF TNY, TINY TINY, Integrase-type DNA-binding superfamily protein (.1) AT4G32800 124 / 2e-36 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT2G25820 120 / 3e-35 AP2_ERF ESE2 ethylene and salt inducible 2, Integrase-type DNA-binding superfamily protein (.1) AT1G01250 115 / 2e-33 AP2_ERF Integrase-type DNA-binding superfamily protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10004738 [exp] 174 / 3e-56 AT2G35700 144 / 7e-44 ERF family protein 38 (.1) Lus10002801 [exp] 131 / 3e-39 AT5G11590 209 / 4e-68 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10034949 [exp] 130 / 9e-38 AT4G32800 169 / 3e-51 Integrase-type DNA-binding superfamily protein (.1) Lus10025834 [exp] 122 / 9e-36 AT5G11590 164 / 2e-50 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10038270 [exp] 121 / 2e-35 AT5G11590 168 / 4e-52 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10043240 [exp] 121 / 5e-35 AT5G11590 176 / 1e-54 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10038607 [exp] 116 / 5e-34 AT5G11590 168 / 1e-52 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10011123 [exp] 114 / 3e-33 AT5G11590 143 / 6e-43 TINY2, Integrase-type DNA-binding superfamily protein (.1) Lus10023873 [exp] 108 / 5e-31 AT2G36450 121 / 3e-35 HARDY, Integrase-type DNA-binding superfamily protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.003G079300 [exp] 137 / 1e-41 AT4G16750 150 / 7e-46 Integrase-type DNA-binding superfamily protein (.1) Potri.001G155700 [exp] 137 / 2e-41 AT2G44940 159 / 1e-47 Integrase-type DNA-binding superfamily protein (.1) Potri.018G085700 [exp] 135 / 6e-40 AT4G32800 155 / 4e-46 Integrase-type DNA-binding superfamily protein (.1) Potri.006G163400 [exp] 132 / 6e-39 AT4G32800 159 / 6e-48 Integrase-type DNA-binding superfamily protein (.1) Potri.018G043900 [exp] 130 / 1e-38 AT5G11590 212 / 5e-69 TINY2, Integrase-type DNA-binding superfamily protein (.1) Potri.003G050700 [exp] 125 / 6e-37 AT5G11590 166 / 5e-51 TINY2, Integrase-type DNA-binding superfamily protein (.1) Potri.002G141200 [exp] 125 / 1e-36 AT2G44940 158 / 6e-47 Integrase-type DNA-binding superfamily protein (.1) Potri.001G187500 [exp] 125 / 1e-36 AT5G25810 157 / 9e-48 TINY, Integrase-type DNA-binding superfamily protein (.1) Potri.014G055700 [exp] 122 / 2e-35 AT2G44940 206 / 2e-65 Integrase-type DNA-binding superfamily protein (.1) Potri.016G018600 [exp] 116 / 1e-33 AT2G36450 135 / 7e-40 HARDY, Integrase-type DNA-binding superfamily protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0081 [flax] [poplar] MBD-like PF00847 [flax] [poplar] AP2 AP2 domain
Representative CDS sequence Show only first row Show all	>Lus10007799 pacid=23143588 polypeptide=Lus10007799 locus=Lus10007799.g ID=Lus10007799.BGIv1.0 annot-version=v1.0 ATGGAACCAACTTCCTCCTCTTCATCATCATCGTCCTCCTCTTCTTCCCCGTCGTCTCCCGACTCCCATTCGTCGGATGTGAAGGCAGGTAGTTCGGACC TCCAGTTCCGGTCGTTTCGTGGGGTGAGGAAGCGGCAATGGGGGAAGTGGGTGTCCGAGATTCGAGAGCCCAAGAAAAAGTCGAGGATCTGGCTGGGGAC CTTCGACACTCCCGAGATGGCGGCCCGCGCCCACGACGTGGCTGCCCTGGCAATTAAAGGGAACTCTGCCCTCCTCAATTTCCCTAAGGAGGCGCATTTG CTCCCCCGCCCTGCGAGCTCTTCTCCTAAGGACGTCCAAGCGGCTGCTGCACTGGCAGGTGCCTTGGACGTCTAG
AA sequence Show only first row Show all	>Lus10007799 pacid=23143588 polypeptide=Lus10007799 locus=Lus10007799.g ID=Lus10007799.BGIv1.0 annot-version=v1.0 MEPTSSSSSSSSSSSSPSSPDSHSSDVKAGSSDLQFRSFRGVRKRQWGKWVSEIREPKKKSRIWLGTFDTPEMAARAHDVAALAIKGNSALLNFPKEAHL LPRPASSSPKDVQAAAALAGALDV

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT2G44940	AP2_ERF		Integrase-type DNA-binding sup...		Lus10007799 [exp]	0	1
AT4G06536			SPla/RYanodine receptor (SPRY)...		Lus10010241 [exp]	8.4	0.7072
AT3G20300			Protein of unknown function (D...		Lus10002334 [exp]	8.5	0.7687
AT2G35700	AP2_ERF	ATERF38	ERF family protein 38 (.1)		Lus10004738 [exp]	10.5	0.7160
AT1G06920	OFP	ATOFP4, OFP4	ARABIDOPSIS THALIANA OVATE FAM...		Lus10025241 [exp]	23.6	0.6684
AT1G30760			FAD-binding Berberine family p...		Lus10038445 [exp]	34.3	0.6933
AT1G64090		RTNLB3	Reticulan like protein B3 (.1....		Lus10039307 [exp]	37.4	0.6088
					Lus10001731 [exp]	43.1	0.6832
AT1G55110	C2H2ZnF	ARABIDOPSISTHAL...	indeterminate(ID)-domain 7 (.1...		Lus10004497 [exp]	47.1	0.6286
AT3G11690			unknown protein		Lus10029349 [exp]	49.4	0.6341
AT1G47240		ATNRAMP2, NRAMP...	NRAMP metal ion transporter 2 ...		Lus10032853 [exp]	84.1	0.6200

Compare expression of checked genes

Lus10007799 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.