Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G48870 167 / 9e-56 SAD1 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) AT4G30330 47 / 2e-08 Small nuclear ribonucleoprotein family protein (.1) AT2G18740 46 / 6e-08 Small nuclear ribonucleoprotein family protein (.1.2) AT1G21190 42 / 4e-06 Small nuclear ribonucleoprotein family protein (.1) AT1G76860 41 / 5e-06 Small nuclear ribonucleoprotein family protein (.1) AT3G14080 39 / 9e-05 Small nuclear ribonucleoprotein family protein (.1.2) AT3G11500 35 / 0.0006 Small nuclear ribonucleoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011877 [exp] 179 / 7e-60 AT5G48870 169 / 8e-56 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Lus10018034 [exp] 46 / 4e-07 AT4G20990 248 / 1e-81 A. THALIANA ALPHA CARBONIC ANHYDRASE 4, alpha carbonic anhydrase 4 (.1) Lus10042030 [exp] 46 / 5e-07 AT4G20990 313 / 9e-107 A. THALIANA ALPHA CARBONIC ANHYDRASE 4, alpha carbonic anhydrase 4 (.1) Lus10026326 [exp] 40 / 1e-05 AT1G76860 176 / 4e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10011293 [exp] 40 / 1e-05 AT1G76860 175 / 8e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10040487 [exp] 40 / 1e-05 AT1G76860 175 / 8e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10042341 [exp] 40 / 4e-05 AT1G76860 132 / 2e-41 Small nuclear ribonucleoprotein family protein (.1) Lus10017019 [exp] 37 / 0.0002 AT3G11500 150 / 2e-49 Small nuclear ribonucleoprotein family protein (.1) Lus10021342 [exp] 36 / 0.0006 AT3G11500 152 / 3e-50 Small nuclear ribonucleoprotein family protein (.1)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G277900 [exp] 172 / 5e-58 AT5G48870 162 / 5e-54 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Potri.009G072500 [exp] 172 / 5e-58 AT5G48870 162 / 5e-54 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Potri.018G096200 [exp] 50 / 2e-09 AT4G30330 166 / 3e-55 Small nuclear ribonucleoprotein family protein (.1) Potri.006G174000 [exp] 50 / 2e-09 AT4G30330 166 / 3e-55 Small nuclear ribonucleoprotein family protein (.1) Potri.002G068800 [exp] 40 / 1e-05 AT1G76860 175 / 1e-58 Small nuclear ribonucleoprotein family protein (.1) Potri.005G191600 [exp] 40 / 1e-05 AT1G76860 176 / 3e-59 Small nuclear ribonucleoprotein family protein (.1) Potri.006G211100 [exp] 37 / 0.0002 AT3G11500 153 / 2e-50 Small nuclear ribonucleoprotein family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0527 [flax] [poplar] Sm-like PF01423 [flax] [poplar] LSM LSM domain
Representative CDS sequence Show only first row Show all	>Lus10022810 pacid=23159915 polypeptide=Lus10022810 locus=Lus10022810.g ID=Lus10022810.BGIv1.0 annot-version=v1.0 ATGGCTAACAACCCTTCGCAGCTGCTTCCATCAGAGCTGATTGATAGGTGCATAGGTTCGAAGATATGGGTGATAATGAAAGGAGACAAAGAGCTTGTGG GAACTCTTAGGGGATTCGACGTCTACGTCAACATGGTCCTCGAAGACGTCACTGAATATGAAATCACTGCTGAAGGTCGGAGGATAACGAAGCTTGACCA GATATTGCTCAATGGAAACAACATCGCCATTTTGGTTCCTGGTGGTTCTCCTGATCCAGAATGA
AA sequence Show only first row Show all	>Lus10022810 pacid=23159915 polypeptide=Lus10022810 locus=Lus10022810.g ID=Lus10022810.BGIv1.0 annot-version=v1.0 MANNPSQLLPSELIDRCIGSKIWVIMKGDKELVGTLRGFDVYVNMVLEDVTEYEITAEGRRITKLDQILLNGNNIAILVPGGSPDPE

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT5G48870		SAD1	SUPERSENSITIVE TO ABA AND DROU...		Lus10022810 [exp]	0	1
AT2G28740		HIS4	histone H4 (.1)		Lus10025964 [exp]	5.7	0.9066
AT5G23420		HMGB6	high-mobility group box 6 (.1....		Lus10013453 [exp]	8.8	0.9016
AT5G37010			unknown protein		Lus10031372 [exp]	12.4	0.8942
AT5G49170			unknown protein		Lus10022872 [exp]	12.6	0.8642
AT2G21580			Ribosomal protein S25 family p...		Lus10034277 [exp]	14.1	0.8549
AT4G16807			unknown protein		Lus10010996 [exp]	15.2	0.8748
AT3G46320			Histone superfamily protein (....		Lus10019956 [exp]	15.2	0.8863
AT1G73940			unknown protein		Lus10017355 [exp]	15.7	0.8450
AT5G38070			RING/FYVE/PHD zinc finger supe...		Lus10002282 [exp]	16.7	0.8527
AT5G43250	CCAAT	NF-YC13	"nuclear factor Y, subunit C13...		Lus10030657 [exp]	18.3	0.8787

Compare expression of checked genes

Lus10022810 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.