Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser]
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G03330 186 / 3e-63 Small nuclear ribonucleoprotein family protein (.1) AT3G59810 39 / 5e-05 Small nuclear ribonucleoprotein family protein (.1) AT3G07590 39 / 0.0001 Small nuclear ribonucleoprotein family protein (.1.2) AT4G02840 38 / 0.0001 Small nuclear ribonucleoprotein family protein (.1.2) AT4G30220 37 / 0.0002 RUXF small nuclear ribonucleoprotein F (.1.2)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10042686 [exp] 195 / 1e-65 AT1G03330 189 / 4e-63 Small nuclear ribonucleoprotein family protein (.1) Lus10000666 [exp] 188 / 7e-64 AT1G03330 184 / 2e-62 Small nuclear ribonucleoprotein family protein (.1) Lus10016013 [exp] 38 / 0.0002 AT1G20580 219 / 3e-75 Small nuclear ribonucleoprotein family protein (.1) Lus10012263 [exp] 38 / 0.0002 AT1G20580 219 / 3e-75 Small nuclear ribonucleoprotein family protein (.1) Lus10030747 [exp] 38 / 0.0002 AT1G20580 214 / 2e-73 Small nuclear ribonucleoprotein family protein (.1) Lus10013227 [exp] 38 / 0.0002 AT1G20580 214 / 2e-73 Small nuclear ribonucleoprotein family protein (.1) Lus10028022 [exp] 38 / 0.0002 AT3G07590 181 / 1e-60 Small nuclear ribonucleoprotein family protein (.1.2) Lus10003727 [exp] 38 / 0.0004 AT3G07590 180 / 1e-58 Small nuclear ribonucleoprotein family protein (.1.2) Lus10025186 [exp] 36 / 0.0006 AT3G07590 169 / 6e-56 Small nuclear ribonucleoprotein family protein (.1.2)
Poplar homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G219000 [exp] 187 / 1e-63 AT1G03330 184 / 1e-62 Small nuclear ribonucleoprotein family protein (.1) Potri.003G014900 [exp] 187 / 1e-63 AT1G03330 184 / 1e-62 Small nuclear ribonucleoprotein family protein (.1) Potri.002G054800 [exp] 39 / 5e-05 AT3G07590 183 / 1e-61 Small nuclear ribonucleoprotein family protein (.1.2) Potri.018G092200 [exp] 37 / 0.0002 AT4G30220 155 / 2e-51 small nuclear ribonucleoprotein F (.1.2) Potri.002G010200 [exp] 36 / 0.001 AT1G20580 214 / 5e-73 Small nuclear ribonucleoprotein family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0527 [flax] [poplar] Sm-like PF01423 [flax] [poplar] LSM LSM domain
Representative CDS sequence Show only first row Show all	>Lus10029641 pacid=23152058 polypeptide=Lus10029641 locus=Lus10029641.g ID=Lus10029641.BGIv1.0 annot-version=v1.0 ATGTTGTTCTTCTCTTACTTCAAAGACCTAGTGGGCAGAGAAGTGACGGTGGAGCTCAAGAACGATTTGGCCATAAGAGGGACGCTTCACTCTGTGGATC AGTACCTCAACATCAAGCTCGAGAACACTCGTGTTGTTGACCAAGACAAGTATCCCCACATGCTTTCAGTGAGGAACTGTTTCATAAGGGGATCGGTGGT AAGATATGTCCAACTGCCAGCAGATGGTGTTGATGTCGATCTGCTTCATGACGCAACCAGGAGAGAAGCTCGTGGTGGTTGA
AA sequence Show only first row Show all	>Lus10029641 pacid=23152058 polypeptide=Lus10029641 locus=Lus10029641.g ID=Lus10029641.BGIv1.0 annot-version=v1.0 MLFFSYFKDLVGREVTVELKNDLAIRGTLHSVDQYLNIKLENTRVVDQDKYPHMLSVRNCFIRGSVVRYVQLPADGVDVDLLHDATRREARGG

---

DESeq2's median of ratios [FLAX]

Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	HYP	R_s2_CTR	R_s2_Fox	R_s4_CTR	R_s4_Fox	R_r1_CTR	R_r1_Fox	R_r3_CTR	R_r3_Fox	R_r1s2_CTR	R_r1s2_Fox	R_r3s2_CTR	R_r3s2_Fox	R_s6_CTR	R_s6_Al4	R_s6_Al12	R_s6_Al24	R_s8_CTR	R_s8_Al4	R_s8_Al12	R_s8_Al24	R_r5_CTR	R_r5_Al4	R_r5_Al12	R_r5_Al24	R_r7_CTR	R_r7_Al4	R_r7_Al12	R_r7_Al24	LEAF_N	LEAF_P	LEAF_NPK	SAM	AR_Bet	AR_rdf	cPAR	TOP_Bet	TOP_rdf	iFIBa	iFIBb	MID_Bet	MID_rdf	tFIBa	tFIB_Gr	tFIB_Li	tFIB_Bi	tFIBb	tFIBb_PUL8	tFIBb_PUL24	tFIBb_PUL96	tFIBb_OPP8	tFIBb_OPP24	tFIBb_OPP96	sXYLa	sXYLb	sXYLb_PUL8	sXYLb_PUL24	sXYLb_PUL96	sXYLb_OPP8	sXYLb_OPP24	sXYLb_OPP96
AT1G03330			Small nuclear ribonucleoprotei...		Lus10029641 [exp]	0	1
AT2G36130			Cyclophilin-like peptidyl-prol...		Lus10017010 [exp]	1.0	0.9435
AT4G32930			unknown protein		Lus10005503 [exp]	2.4	0.9098
AT5G05210			Surfeit locus protein 6 (.1.2)		Lus10014455 [exp]	2.8	0.9129
AT3G45020			Ribosomal L18p/L5e family prot...		Lus10016132 [exp]	3.2	0.8883
AT3G25120			Mitochondrial import inner mem...		Lus10008094 [exp]	3.2	0.9032
AT5G22080			Chaperone DnaJ-domain superfam...		Lus10004099 [exp]	6.3	0.9059
AT1G03330			Small nuclear ribonucleoprotei...		Lus10042686 [exp]	6.9	0.9007
AT5G05210			Surfeit locus protein 6 (.1.2)		Lus10023712 [exp]	7.3	0.8951
AT4G14965		ATMAPR4	membrane-associated progestero...		Lus10042022 [exp]	8.5	0.8822
AT3G15660		ATGRX4	A. THALIANA GLUTAREDOXIN 4, gl...		Lus10008687 [exp]	9.4	0.8396

Compare expression of checked genes

Lus10029641 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.