Potri.001G289900 [POPLAR]


External link
JGI Phytozome v13PopgenieAspWood                  
Symbol
Arabidopsis homologues
Locus ID BLAST score/e-value TF class Alias TAIR10 short description
AT1G12500 149 / 7e-45 Nucleotide-sugar transporter family protein (.1)
AT3G11320 121 / 9e-35 Nucleotide-sugar transporter family protein (.1)
AT5G05820 119 / 7e-34 Nucleotide-sugar transporter family protein (.1)
AT5G04160 116 / 8e-33 Nucleotide-sugar transporter family protein (.1)
AT3G10290 114 / 6e-32 Nucleotide-sugar transporter family protein (.1)
AT1G77610 45 / 2e-06 EamA-like transporter family protein (.1)
AT3G01550 45 / 2e-06 ATPPT2 phosphoenolpyruvate (pep)/phosphate translocator 2 (.1)
AT1G21870 43 / 9e-06 GONST5 golgi nucleotide sugar transporter 5 (.1)
AT4G32390 41 / 6e-05 Nucleotide-sugar transporter family protein (.1)
AT5G25400 40 / 0.0001 Nucleotide-sugar transporter family protein (.1)
Paralogs
Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Potri.003G118000 167 / 6e-52 AT1G12500 503 / 4e-180 Nucleotide-sugar transporter family protein (.1)
Potri.001G114100 164 / 9e-51 AT1G12500 483 / 8e-172 Nucleotide-sugar transporter family protein (.1)
Potri.001G247600 123 / 1e-35 AT3G11320 476 / 4e-171 Nucleotide-sugar transporter family protein (.1)
Potri.009G040800 120 / 2e-34 AT5G05820 472 / 2e-169 Nucleotide-sugar transporter family protein (.1)
Potri.010G194100 119 / 3e-34 AT3G11320 572 / 0.0 Nucleotide-sugar transporter family protein (.1)
Potri.016G043200 119 / 5e-34 AT5G04160 512 / 0.0 Nucleotide-sugar transporter family protein (.1)
Potri.006G046600 118 / 9e-34 AT5G04160 503 / 0.0 Nucleotide-sugar transporter family protein (.1)
Potri.008G063400 116 / 6e-33 AT3G11320 566 / 0.0 Nucleotide-sugar transporter family protein (.1)
Potri.002G084500 43 / 9e-06 AT1G77610 580 / 0.0 EamA-like transporter family protein (.1)
Flax homologues
Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description
Lus10006684 160 / 2e-50 AT1G12500 439 / 2e-156 Nucleotide-sugar transporter family protein (.1)
Lus10007029 160 / 8e-50 AT1G12500 457 / 2e-162 Nucleotide-sugar transporter family protein (.1)
Lus10009878 123 / 1e-35 AT3G11320 548 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10016446 122 / 5e-35 AT5G05820 508 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10028255 114 / 1e-31 AT3G11320 523 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10040234 113 / 1e-31 AT3G11320 527 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10042039 109 / 3e-30 AT3G10290 526 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10018043 109 / 4e-30 AT3G10290 528 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10014832 106 / 9e-29 AT3G11320 530 / 0.0 Nucleotide-sugar transporter family protein (.1)
Lus10013083 47 / 5e-07 AT3G01550 429 / 1e-149 phosphoenolpyruvate (pep)/phosphate translocator 2 (.1)
PFAM info
Clan ID Clan name Pfam ID Pfam name Pfam description
CL0184 DMT PF03151 TPT Triose-phosphate Transporter family
Representative CDS sequence
>Potri.001G289900.1 pacid=42793716 polypeptide=Potri.001G289900.1.p locus=Potri.001G289900 ID=Potri.001G289900.1.v4.1 annot-version=v4.1
ATGTACTTGCCTGTGTCTTTTAATCAAGCTATTGGGGCAACAACACCATTTTTTTCTGCTAATTTTGCTTTCTTGATAACTTGCAAGGAAGAATCTGTTG
AGGTTTCTTGTGCACTTTTGCCTGTGGTTTTTGGGATTGTTTTGGCTAGTAATAGTGAGCATTTGTTTCATTTATTTGGGTTCTTGGTCTGTGCTGGTTC
AACTGCTGGACGTGCTTTAAAATCTGTGGTTCAAGGGATTTTGTTAACATCAGAAGCTGAGAAGTTACATTCTAGGCGAGAGTTGCCAAAACCCGCGAAT
CACGTCTTCCTTCCCTCTCTGCAGCTCCAAAACTAG
AA sequence
>Potri.001G289900.1 pacid=42793716 polypeptide=Potri.001G289900.1.p locus=Potri.001G289900 ID=Potri.001G289900.1.v4.1 annot-version=v4.1
MYLPVSFNQAIGATTPFFSANFAFLITCKEESVEVSCALLPVVFGIVLASNSEHLFHLFGFLVCAGSTAGRALKSVVQGILLTSEAEKLHSRRELPKPAN
HVFLPSLQLQN

DESeq2's median of ratios [POPLAR]

Mapped by: Order by: Show schematic diagram

Coexpressed genes

Only top 10 genes are shown Show allDownload tab-delimited text
Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.
At best At TF class At alias At description Locus MR r Symbol NWA:WTNWB:WTNWA:OE-ARK2NWB:OE-ARK2NWA:miRNA-ARK2NWB:miRNA-ARK2NW 0hrWT H20WT-NWTUA1dEY NWTUA1dEY+TUB15 NWTUA1dY+TUB9 NWPde NWNWA:WT GANWBWT GATW:WTTW:WT GANWA:OE-ARK2 GANWB:OE-ARK2 GATW:OE-ARK2TW:OE-ARK2 GANWA:miRNA-ARK2 GANWB:miRNA-ARK2 GATW:miRNA-ARK2TW:miRNA-ARK2 GATW 2hrTW 8hrTW 24hrTW 48hrTW 96hrTW 336hrWT ACC35S::etr1-1 H2035S::etr1-1 ACCLMX5::etr1-1 H20LMX5::etr1-1 ACCWT-TWTUA1dEY TWTUA1dEY+TUB15 TWTUA1dY+TUB9 TWPde TWOW:WTOW:WT GAOW:OE-ARK2OW:OE-ARK2 GAOW:miRNA-ARK2OW:miRNA-ARK2 GAOW 2hrOW 8hrOW 24hrOW 48hrOW 96hrOW 336hrRoot CTRRoot LongColdRoot LongDrougtRoot LongHeatRoot LongSaltRoot ShortColdRoot ShortDrougtRoot ShortHeatRoot ShortSaltPtr rootLeaf CTRLeaf LongColdLeaf LongDrougtLeaf LongHeatLeaf LongSaltLeaf ShortColdLeaf ShortDrougtLeaf ShortHeatLeaf ShortSaltPtr leafStem CTRStem LongColdStem LongDrougtStem LongHeatStem LongSaltStem ShortColdStem ShortDrougtStem ShortHeatStem ShortSaltPtr shootPtr xylemPtr phloemPtr fiberPtr vesselPtr fiber vessel ray
AT1G12500 Nucleotide-sugar transporter f... Potri.001G289900 0 1
AT3G09370 MYB ATMYB3R-3, ATMY... myb domain protein 3R3, myb do... Potri.003G123800 1.00 0.7174
AT5G17440 LUC7 related protein (.1) Potri.013G084800 11.22 0.6780
Potri.002G208637 17.17 0.6340
AT5G12235 CLE22 CLAVATA3/ESR-RELATED 22 (.1) Potri.016G034950 22.71 0.6159
AT3G58600 Adaptin ear-binding coat-assoc... Potri.019G089800 26.98 0.6441
AT1G65550 Xanthine/uracil permease famil... Potri.014G015100 27.74 0.6693
AT4G39690 unknown protein Potri.005G080200 29.84 0.6105
Potri.004G099900 31.46 0.6890
AT1G76750 Protein of unknown function (D... Potri.009G077000 32.44 0.6719
AT5G58510 unknown protein Potri.001G280832 47.81 0.6581

Potri.001G289900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.