Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT1G03330 185 / 9e-63 Small nuclear ribonucleoprotein family protein (.1) AT4G30220 38 / 0.0001 RUXF small nuclear ribonucleoprotein F (.1.2) AT4G02840 38 / 0.0001 Small nuclear ribonucleoprotein family protein (.1.2) AT3G07590 38 / 0.0001 Small nuclear ribonucleoprotein family protein (.1.2) AT3G59810 37 / 0.0002 Small nuclear ribonucleoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G219000 [exp] 192 / 1e-65 AT1G03330 184 / 1e-62 Small nuclear ribonucleoprotein family protein (.1) Potri.018G092200 [exp] 41 / 8e-06 AT4G30220 155 / 2e-51 small nuclear ribonucleoprotein F (.1.2) Potri.002G054800 [exp] 39 / 6e-05 AT3G07590 183 / 1e-61 Small nuclear ribonucleoprotein family protein (.1.2)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10000666 [exp] 188 / 5e-64 AT1G03330 184 / 2e-62 Small nuclear ribonucleoprotein family protein (.1) Lus10042686 [exp] 190 / 1e-63 AT1G03330 189 / 4e-63 Small nuclear ribonucleoprotein family protein (.1) Lus10029641 [exp] 187 / 2e-63 AT1G03330 186 / 4e-63 Small nuclear ribonucleoprotein family protein (.1) Lus10016013 [exp] 38 / 0.0002 AT1G20580 219 / 3e-75 Small nuclear ribonucleoprotein family protein (.1) Lus10012263 [exp] 38 / 0.0002 AT1G20580 219 / 3e-75 Small nuclear ribonucleoprotein family protein (.1) Lus10030747 [exp] 38 / 0.0002 AT1G20580 214 / 2e-73 Small nuclear ribonucleoprotein family protein (.1) Lus10013227 [exp] 38 / 0.0002 AT1G20580 214 / 2e-73 Small nuclear ribonucleoprotein family protein (.1) Lus10028022 [exp] 38 / 0.0002 AT3G07590 181 / 1e-60 Small nuclear ribonucleoprotein family protein (.1.2) Lus10037606 [exp] 37 / 0.0002 AT4G30220 173 / 2e-58 small nuclear ribonucleoprotein F (.1.2) Lus10003727 [exp] 38 / 0.0003 AT3G07590 180 / 1e-58 Small nuclear ribonucleoprotein family protein (.1.2)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0527 [poplar] [flax] Sm-like PF01423 [poplar] [flax] LSM LSM domain
Representative CDS sequence Show only first row Show all	>Potri.003G014900.1 pacid=42786062 polypeptide=Potri.003G014900.1.p locus=Potri.003G014900 ID=Potri.003G014900.1.v4.1 annot-version=v4.1 ATGTTGTTTTTTTCGTATTTCAAGGATTTGGTAGGGAAAGAAGTGACGGTGGAGCTGAAGAATGATTTGGCTATAAGAGGGACTCTTCACTCTGTGGATC AGTACCTCAACATCAAGCTCGAAAACACTCGCGTTGTCGATCAAGACAAGTATCCTCACATGCTTTCTGTCAGGAACTGTTTCATAAGGGGATCAGTAGT GAGATATGTTCAACTTCCTCCAGAGGGTGTGGATGTTGATCTGCTTCACGATGCCACGAGAAGGGAAGCTCGGGGTGGCTGA
AA sequence Show only first row Show all	>Potri.003G014900.1 pacid=42786062 polypeptide=Potri.003G014900.1.p locus=Potri.003G014900 ID=Potri.003G014900.1.v4.1 annot-version=v4.1 MLFFSYFKDLVGKEVTVELKNDLAIRGTLHSVDQYLNIKLENTRVVDQDKYPHMLSVRNCFIRGSVVRYVQLPPEGVDVDLLHDATRREARGG

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT1G03330			Small nuclear ribonucleoprotei...		Potri.003G014900 [exp]	0	1
AT1G71260		WHY2, ATWHY2	WHIRLY 2 (.1)		Potri.003G048700 [exp]	1.41	0.8278
AT5G56130		THO3, AtTEX1	Transducin/WD40 repeat-like su...		Potri.001G470900 [exp]	4.47	0.7619
AT4G29830		VIP3	vernalization independence 3, ...		Potri.006G145800 [exp]	4.47	0.8101
					Potri.011G077440 [exp]	4.89	0.7870
AT3G46940		DUT1	DUTP-PYROPHOSPHATASE-LIKE 1 (....		Potri.002G261900 [exp]	4.89	0.7917
AT3G18030		ATHAL3A	HALOTOLERANCE DETERMINANT 3, A...		Potri.015G089600 [exp]	6.24	0.8002
AT2G45640		ATSAP18, HDA19	SIN3 ASSOCIATED POLYPEPTIDE 18...		Potri.003G119300 [exp]	9.00	0.7286
AT4G26410			Uncharacterised conserved prot...		Potri.001G001300 [exp]	9.79	0.7590
AT1G54690		HTA3 ,G-H2AX ,G...	histone H2A 3, GAMMA H2AX, gam...		Potri.005G040800 [exp]	12.48	0.7983
AT5G09250		KIWI	ssDNA-binding transcriptional ...		Potri.007G101100 [exp]	12.96	0.7023	KIWI.1

Compare expression of checked genes

Potri.003G014900 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.