Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G47220 111 / 1e-30 AP2_ERF ATERF-2, ERF2, ATERF2 ETHYLENE RESPONSE FACTOR- 2, ethylene responsive element binding factor 2 (.1) AT4G17500 110 / 5e-30 AP2_ERF ATERF-1, AtERF1 ethylene responsive element binding factor 1 (.1) AT3G23240 108 / 2e-29 AP2_ERF ERF1, ATERF1 ethylene response factor 1 (.1) AT2G44840 100 / 4e-26 AP2_ERF ATERF13, EREBP ethylene-responsive element binding factor 13 (.1) AT4G17490 97 / 2e-24 AP2_ERF ERF-6-6, ATERF6 ethylene responsive element binding factor 6 (.1) AT5G51190 94 / 4e-24 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT5G47230 96 / 7e-24 AP2_ERF ATERF5, ATERF-5, ERF5 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR- 5, ethylene responsive element binding factor 5 (.1) AT5G61600 90 / 3e-22 AP2_ERF ERF104 ethylene response factor 104 (.1) AT5G43410 86 / 6e-22 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT1G06160 89 / 7e-22 AP2_ERF ORA59 octadecanoid-responsive Arabidopsis AP2/ERF 59 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.011G061700 [exp] 245 / 9e-84 AT3G23240 111 / 1e-30 ethylene response factor 1 (.1) Potri.010G072300 [exp] 106 / 7e-29 AT3G23240 201 / 2e-65 ethylene response factor 1 (.1) Potri.001G154100 [exp] 107 / 1e-28 AT4G17500 221 / 2e-71 ethylene responsive element binding factor 1 (.1) Potri.008G166200 [exp] 105 / 2e-28 AT3G23240 202 / 1e-65 ethylene response factor 1 (.1) Potri.013G045200 [exp] 104 / 8e-28 AT3G23240 167 / 5e-52 ethylene response factor 1 (.1) Potri.003G081200 [exp] 104 / 1e-27 AT4G17500 211 / 1e-67 ethylene responsive element binding factor 1 (.1) Potri.004G051800 [exp] 103 / 3e-27 AT4G18450 127 / 7e-35 Integrase-type DNA-binding superfamily protein (.1) Potri.005G223200 [exp] 100 / 2e-26 AT3G23240 165 / 4e-51 ethylene response factor 1 (.1) Potri.003G150800 [exp] 99 / 3e-25 AT5G51190 185 / 7e-58 Integrase-type DNA-binding superfamily protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025430 [exp] 125 / 6e-37 AT3G23240 132 / 6e-39 ethylene response factor 1 (.1) Lus10013959 [exp] 124 / 7e-37 AT3G23240 124 / 2e-36 ethylene response factor 1 (.1) Lus10005285 [exp] 117 / 1e-33 AT3G23240 120 / 1e-34 ethylene response factor 1 (.1) Lus10011829 [exp] 108 / 4e-29 AT3G23240 209 / 4e-68 ethylene response factor 1 (.1) Lus10021193 [exp] 104 / 8e-28 AT3G23240 209 / 2e-68 ethylene response factor 1 (.1) Lus10014655 [exp] 98 / 4e-25 AT3G23240 202 / 3e-65 ethylene response factor 1 (.1) Lus10004368 [exp] 98 / 6e-25 AT4G17500 268 / 7e-90 ethylene responsive element binding factor 1 (.1) Lus10042996 [exp] 97 / 1e-24 AT5G51190 189 / 6e-60 Integrase-type DNA-binding superfamily protein (.1) Lus10032499 [exp] 96 / 2e-24 AT5G51190 186 / 8e-59 Integrase-type DNA-binding superfamily protein (.1) Lus10022015 [exp] 95 / 2e-24 AT3G23240 176 / 1e-55 ethylene response factor 1 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0081 [poplar] [flax] MBD-like PF00847 [poplar] [flax] AP2 AP2 domain
Representative CDS sequence Show only first row Show all	>Potri.004G051700.1 pacid=42795552 polypeptide=Potri.004G051700.1.p locus=Potri.004G051700 ID=Potri.004G051700.1.v4.1 annot-version=v4.1 ATGGTATTAACCTCCCAGAGCCATGATCTCCCTTTAAATGAGAATGACTCGCAAGACATGGTCATATACCATATGATCAGTGAGATCAGTGCCCCAAATA GCAGTTCAAATAATACGCTTCCAAGAAGCCATATCAACACTTCAGGCATGCTCCAACCAGCTAGGACAGCCGTAGCAAAGAAGCACTACAGAGGCGTGAG GCGTCGGCCATGGGGCAAATATGCTGCCGAAATTCGCGACTCCAGGCGACGCGGGGCCCGTATATGGCTAGGCACATTCGAAACGGCAGAGGAGGCTGCC TTGGCTTATGATAGGGCTGCTTTTAACATGCGCGGCTCTAAGGCCCTCCTTAATTTTCCAGCTGAAGTGGTTGCTGCAGCTACATCAGCTCAAAACTTTC AGCCAATTTTGAGCTCAACAAGGTCAAGTAAAAATGCTTTGGATACAAGTTTTAGCTGTAGGACAATATCAATTGCAGCATCGCAACCTGAATCACAGAG TAGCAAAAGTGGGGAGCCGCGTCATAAGGGGCCTGATATCGTAGAGAATTAA
AA sequence Show only first row Show all	>Potri.004G051700.1 pacid=42795552 polypeptide=Potri.004G051700.1.p locus=Potri.004G051700 ID=Potri.004G051700.1.v4.1 annot-version=v4.1 MVLTSQSHDLPLNENDSQDMVIYHMISEISAPNSSSNNTLPRSHINTSGMLQPARTAVAKKHYRGVRRRPWGKYAAEIRDSRRRGARIWLGTFETAEEAA LAYDRAAFNMRGSKALLNFPAEVVAAATSAQNFQPILSSTRSSKNALDTSFSCRTISIAASQPESQSSKSGEPRHKGPDIVEN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G47220	AP2_ERF	ATERF-2, ERF2, ...	ETHYLENE RESPONSE FACTOR- 2, e...		Potri.004G051700 [exp]	0	1
AT1G01720	NAC	ATAF1, ANAC002	Arabidopsis NAC domain contain...		Potri.002G081000 [exp]	1.00	0.9090	Pt-ATAF1.2
AT2G19260			RING/FYVE/PHD zinc finger supe...		Potri.006G277400 [exp]	4.89	0.8548
AT3G47780		ABCA7, ATATH6	A. THALIANA ABC2 HOMOLOG 6, AT...		Potri.012G069700 [exp]	6.32	0.8915	PtrAOH3,ATH2.3
AT3G63380			ATPase E1-E2 type family prote...		Potri.005G215600 [exp]	7.41	0.8780
AT5G38280		PR5K	PR5-like receptor kinase (.1)		Potri.017G009500 [exp]	11.22	0.8711
AT5G41350			RING/U-box superfamily protein...		Potri.003G129900 [exp]	11.48	0.8746
AT3G27320			alpha/beta-Hydrolases superfam...		Potri.008G180500 [exp]	12.00	0.8875
AT2G27580			A20/AN1-like zinc finger famil...		Potri.009G144100 [exp]	13.03	0.7991
AT5G48380		BIR1	BAK1-interacting receptor-like...		Potri.010G178050 [exp]	16.49	0.8796
AT3G01360			Family of unknown function (DU...		Potri.005G122800 [exp]	21.02	0.8256

Compare expression of checked genes

Potri.004G051700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.