Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol	SAD1.1
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT5G48870 162 / 4e-54 SAD1 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) AT4G30330 50 / 2e-09 Small nuclear ribonucleoprotein family protein (.1) AT2G18740 48 / 1e-08 Small nuclear ribonucleoprotein family protein (.1.2) AT1G21190 42 / 4e-06 Small nuclear ribonucleoprotein family protein (.1) AT1G76860 41 / 5e-06 Small nuclear ribonucleoprotein family protein (.1) AT3G14080 40 / 2e-05 Small nuclear ribonucleoprotein family protein (.1.2) AT3G11500 35 / 0.0007 Small nuclear ribonucleoprotein family protein (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.001G277900 [exp] 179 / 1e-60 AT5G48870 162 / 5e-54 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Potri.018G096200 [exp] 52 / 2e-10 AT4G30330 166 / 3e-55 Small nuclear ribonucleoprotein family protein (.1) Potri.006G174000 [exp] 52 / 2e-10 AT4G30330 166 / 3e-55 Small nuclear ribonucleoprotein family protein (.1) Potri.002G068800 [exp] 41 / 8e-06 AT1G76860 175 / 1e-58 Small nuclear ribonucleoprotein family protein (.1) Potri.005G191600 [exp] 40 / 9e-06 AT1G76860 176 / 3e-59 Small nuclear ribonucleoprotein family protein (.1) Potri.006G211100 [exp] 37 / 0.0003 AT3G11500 153 / 2e-50 Small nuclear ribonucleoprotein family protein (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10011877 [exp] 175 / 4e-58 AT5G48870 169 / 8e-56 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Lus10022810 [exp] 172 / 6e-58 AT5G48870 167 / 8e-56 SUPERSENSITIVE TO ABA AND DROUGHT 1, Small nuclear ribonucleoprotein family protein (.1) Lus10018034 [exp] 47 / 2e-07 AT4G20990 248 / 1e-81 A. THALIANA ALPHA CARBONIC ANHYDRASE 4, alpha carbonic anhydrase 4 (.1) Lus10042030 [exp] 47 / 2e-07 AT4G20990 313 / 9e-107 A. THALIANA ALPHA CARBONIC ANHYDRASE 4, alpha carbonic anhydrase 4 (.1) Lus10026326 [exp] 40 / 1e-05 AT1G76860 176 / 4e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10011293 [exp] 40 / 1e-05 AT1G76860 175 / 8e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10040487 [exp] 40 / 1e-05 AT1G76860 175 / 8e-59 Small nuclear ribonucleoprotein family protein (.1) Lus10042341 [exp] 40 / 4e-05 AT1G76860 132 / 2e-41 Small nuclear ribonucleoprotein family protein (.1) Lus10017019 [exp] 37 / 0.0002 AT3G11500 150 / 2e-49 Small nuclear ribonucleoprotein family protein (.1) Lus10021342 [exp] 35 / 0.0007 AT3G11500 152 / 3e-50 Small nuclear ribonucleoprotein family protein (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0527 [poplar] [flax] Sm-like PF01423 [poplar] [flax] LSM LSM domain
Representative CDS sequence Show only first row Show all	>Potri.009G072500.1 pacid=42772453 polypeptide=Potri.009G072500.1.p locus=Potri.009G072500 ID=Potri.009G072500.1.v4.1 annot-version=v4.1 ATGGCCAACACCAATCCCTCACAGCTCCTTCCGTCAGAGCTCATAGACAGGTGCATAGGGTCGAAAATATGGGTCATAATGAAAGGAGACAAGGAGCTTG TTGGTACTCTCAGGGGTTTTGACGTCTATGTCAACATGGTCCTTGAAGACGTTACTGAATATGAAATTACAGCTGAAGGGCGACGCATAACCAAGCTTGA TCAGATATTGCTGAATGGAAATAACATTGCCATTCTCGTTCCTGGTGGTTCCCCTGATCCAGAATGA
AA sequence Show only first row Show all	>Potri.009G072500.1 pacid=42772453 polypeptide=Potri.009G072500.1.p locus=Potri.009G072500 ID=Potri.009G072500.1.v4.1 annot-version=v4.1 MANTNPSQLLPSELIDRCIGSKIWVIMKGDKELVGTLRGFDVYVNMVLEDVTEYEITAEGRRITKLDQILLNGNNIAILVPGGSPDPE

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT5G48870		SAD1	SUPERSENSITIVE TO ABA AND DROU...		Potri.009G072500 [exp]	0	1	SAD1.1
AT2G20740			Tetraspanin family protein (.1...		Potri.013G134200 [exp]	2.23	0.7621
AT3G54640		TRP3, TSA1	TRYPTOPHAN-REQUIRING 3, trypto...		Potri.002G045700 [exp]	2.82	0.7255	TSA1.2
AT2G26590		RPN13	regulatory particle non-ATPase...		Potri.006G078800 [exp]	5.29	0.7513
AT1G28120			unknown protein		Potri.003G162600 [exp]	6.48	0.6994
AT3G12180			Cornichon family protein (.1)		Potri.006G057300 [exp]	7.00	0.6945
AT1G02410			cytochrome c oxidase assembly ...		Potri.001G078500 [exp]	11.31	0.6635
AT5G05800			unknown protein		Potri.004G135901 [exp]	11.66	0.6883
AT3G48030			hypoxia-responsive family prot...		Potri.015G073300 [exp]	18.30	0.7113
AT1G75720			Plant protein of unknown funct...		Potri.005G238500 [exp]	19.36	0.6656
AT1G23360		MENG	S-adenosyl-L-methionine-depend...		Potri.008G188600 [exp]	20.90	0.6578

Compare expression of checked genes

Potri.009G072500 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.