Plant FIBer expression Database

External link	JGI Phytozome v13 [genome browser] Popgenie AspWood
Symbol
Arabidopsis homologues Show only best Show top 10	Locus ID BLAST score/e-value TF class Alias TAIR10 short description AT3G23240 111 / 1e-30 AP2_ERF ERF1, ATERF1 ethylene response factor 1 (.1) AT5G47220 110 / 6e-30 AP2_ERF ATERF-2, ERF2, ATERF2 ETHYLENE RESPONSE FACTOR- 2, ethylene responsive element binding factor 2 (.1) AT4G17500 107 / 1e-28 AP2_ERF ATERF-1, AtERF1 ethylene responsive element binding factor 1 (.1) AT2G44840 100 / 4e-26 AP2_ERF ATERF13, EREBP ethylene-responsive element binding factor 13 (.1) AT5G43410 90 / 2e-23 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT5G51190 92 / 4e-23 AP2_ERF Integrase-type DNA-binding superfamily protein (.1) AT4G17490 93 / 5e-23 AP2_ERF ERF-6-6, ATERF6 ethylene responsive element binding factor 6 (.1) AT5G47230 93 / 5e-23 AP2_ERF ATERF5, ATERF-5, ERF5 ETHYLENE RESPONSIVE ELEMENT BINDING FACTOR- 5, ethylene responsive element binding factor 5 (.1) AT3G23220 89 / 5e-23 AP2_ERF ESE1 ethylene and salt inducible 1, Integrase-type DNA-binding superfamily protein (.1) AT5G61600 89 / 5e-22 AP2_ERF ERF104 ethylene response factor 104 (.1)
Paralogs Show only best Show top 10	Gene ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Potri.004G051700 [exp] 231 / 5e-78 AT5G47220 111 / 1e-30 ETHYLENE RESPONSE FACTOR- 2, ethylene responsive element binding factor 2 (.1) Potri.008G166200 [exp] 113 / 3e-31 AT3G23240 202 / 1e-65 ethylene response factor 1 (.1) Potri.010G072300 [exp] 111 / 1e-30 AT3G23240 201 / 2e-65 ethylene response factor 1 (.1) Potri.013G045200 [exp] 108 / 2e-29 AT3G23240 167 / 5e-52 ethylene response factor 1 (.1) Potri.001G154100 [exp] 104 / 2e-27 AT4G17500 221 / 2e-71 ethylene responsive element binding factor 1 (.1) Potri.003G081200 [exp] 103 / 6e-27 AT4G17500 211 / 1e-67 ethylene responsive element binding factor 1 (.1) Potri.003G150800 [exp] 100 / 6e-26 AT5G51190 185 / 7e-58 Integrase-type DNA-binding superfamily protein (.1) Potri.005G223200 [exp] 99 / 6e-26 AT3G23240 165 / 4e-51 ethylene response factor 1 (.1) Potri.014G046600 [exp] 99 / 1e-25 AT2G44840 196 / 3e-63 ethylene-responsive element binding factor 13 (.1)
Flax homologues Show only best Show top 10	Locus ID BLAST score/e-value At best hit BLAST score/e-value TAIR10 short description Lus10025430 [exp] 130 / 1e-38 AT3G23240 132 / 6e-39 ethylene response factor 1 (.1) Lus10013959 [exp] 127 / 4e-38 AT3G23240 124 / 2e-36 ethylene response factor 1 (.1) Lus10005285 [exp] 120 / 3e-35 AT3G23240 120 / 1e-34 ethylene response factor 1 (.1) Lus10021193 [exp] 116 / 2e-32 AT3G23240 209 / 2e-68 ethylene response factor 1 (.1) Lus10011829 [exp] 114 / 2e-31 AT3G23240 209 / 4e-68 ethylene response factor 1 (.1) Lus10014655 [exp] 103 / 2e-27 AT3G23240 202 / 3e-65 ethylene response factor 1 (.1) Lus10022015 [exp] 100 / 5e-26 AT3G23240 176 / 1e-55 ethylene response factor 1 (.1) Lus10004368 [exp] 99 / 6e-25 AT4G17500 268 / 7e-90 ethylene responsive element binding factor 1 (.1) Lus10006579 [exp] 96 / 1e-24 AT3G23240 211 / 4e-69 ethylene response factor 1 (.1) Lus10003562 [exp] 94 / 9e-24 AT3G23240 146 / 1e-43 ethylene response factor 1 (.1)
PFAM info	Clan ID Clan name Pfam ID Pfam name Pfam description CL0081 [poplar] [flax] MBD-like PF00847 [poplar] [flax] AP2 AP2 domain
Representative CDS sequence Show only first row Show all	>Potri.011G061700.2 pacid=42782200 polypeptide=Potri.011G061700.2.p locus=Potri.011G061700 ID=Potri.011G061700.2.v4.1 annot-version=v4.1 ATGGTATTAAGCTCCCAGATCCATGAGCTCCCCTTTAATGAGAATGACTCACAAGACATGGTCATATATCAGATGATCAACGAGGCCAGCGCCCCGAATA GCAGTACATATAATATACTTCCGAGAAGCCAAATCAACACTTCAGGCATGCTCCAACCAGCGAGGACAGTCATAGCAAAGAAGCATTACCGGGGCGTGAG GCGTCGGCCATGGGGGAAATATGCTGCAGAAATTCGTGACTCCAAAAGACACGGGGCTCGTATATGGCTAGGCACATTCGAAACGGCGGAGGCGGCTGCC CTGGCTTATGATAGGGCTGCTTTTAACATGCGTGGCTCTAAGGCCCTCCTGAATTTTCCAGCTGAAGTGGTGGCTGCTATATCAACTCAAAACTGTCAGC CAATTTTTAGCTCAACAAGGACGTCAAGTAAAAAAGCTATGGATTCATGCGGTAGCTCTAGCACAATAACTATTGCAACATCACAATCTGAATCAGAGAG CAGCACAAGTGGGGAGTCACGCCGTCAGGGGTCGGATATCCTCGAGAATTAA
AA sequence Show only first row Show all	>Potri.011G061700.2 pacid=42782200 polypeptide=Potri.011G061700.2.p locus=Potri.011G061700 ID=Potri.011G061700.2.v4.1 annot-version=v4.1 MVLSSQIHELPFNENDSQDMVIYQMINEASAPNSSTYNILPRSQINTSGMLQPARTVIAKKHYRGVRRRPWGKYAAEIRDSKRHGARIWLGTFETAEAAA LAYDRAAFNMRGSKALLNFPAEVVAAISTQNCQPIFSSTRTSSKKAMDSCGSSSTITIATSQSESESSTSGESRRQGSDILEN

---

DESeq2's median of ratios [POPLAR]

Mapped by: StringTie Salmon Order by: Tissue Experiment Show only core collection Show again Show schematic diagram

---

Coexpressed genes

Compare expression of checked genes Schematic diagram [FLAX] Schematic diagram [POPLAR]

*If you select 4 or less genes and then press "compare expression", expression will be shown as a graph. If you select more than 4 genes, expresion will be shown as a heat map.
*Color represents relative expression level among samples for each gene.

At best	At TF class	At alias	At description		Locus	MR	r	Symbol	NWA:WT	NWB:WT	NWA:OE-ARK2	NWB:OE-ARK2	NWA:miRNA-ARK2	NWB:miRNA-ARK2	NW 0hr	WT H20	WT-NW	TUA1dEY NW	TUA1dEY+TUB15 NW	TUA1dY+TUB9 NW	Pde NW	NWA:WT GA	NWBWT GA	TW:WT	TW:WT GA	NWA:OE-ARK2 GA	NWB:OE-ARK2 GA	TW:OE-ARK2	TW:OE-ARK2 GA	NWA:miRNA-ARK2 GA	NWB:miRNA-ARK2 GA	TW:miRNA-ARK2	TW:miRNA-ARK2 GA	TW 2hr	TW 8hr	TW 24hr	TW 48hr	TW 96hr	TW 336hr	WT ACC	35S::etr1-1 H20	35S::etr1-1 ACC	LMX5::etr1-1 H20	LMX5::etr1-1 ACC	WT-TW	TUA1dEY TW	TUA1dEY+TUB15 TW	TUA1dY+TUB9 TW	Pde TW	OW:WT	OW:WT GA	OW:OE-ARK2	OW:OE-ARK2 GA	OW:miRNA-ARK2	OW:miRNA-ARK2 GA	OW 2hr	OW 8hr	OW 24hr	OW 48hr	OW 96hr	OW 336hr	Root CTR	Root LongCold	Root LongDrougt	Root LongHeat	Root LongSalt	Root ShortCold	Root ShortDrougt	Root ShortHeat	Root ShortSalt	Ptr root	Leaf CTR	Leaf LongCold	Leaf LongDrougt	Leaf LongHeat	Leaf LongSalt	Leaf ShortCold	Leaf ShortDrougt	Leaf ShortHeat	Leaf ShortSalt	Ptr leaf	Stem CTR	Stem LongCold	Stem LongDrougt	Stem LongHeat	Stem LongSalt	Stem ShortCold	Stem ShortDrougt	Stem ShortHeat	Stem ShortSalt	Ptr shoot	Ptr xylem	Ptr phloem	Ptr fiber	Ptr vessel	Ptr fiber vessel ray
AT3G23240	AP2_ERF	ERF1, ATERF1	ethylene response factor 1 (.1...		Potri.011G061700 [exp]	0	1
AT1G32350		AOX1D	alternative oxidase 1D (.1)		Potri.003G103900 [exp]	1.00	0.9838
AT1G29290			unknown protein		Potri.004G061300 [exp]	2.44	0.9580
AT3G27150			Galactose oxidase/kelch repeat...		Potri.001G331500 [exp]	4.89	0.9494
AT2G18700		ATTPSB, ATTPS11	TREHALOSE-6-PHOSPHATE SYNTHASE...		Potri.006G175500 [exp]	6.48	0.9241	Pt-ATTPS11.1
AT1G76650		CML38	calmodulin-like 38 (.1.2.3)		Potri.001G332900 [exp]	7.00	0.9389
AT1G64160			Disease resistance-responsive ...		Potri.005G100700 [exp]	7.07	0.9302
AT1G29290			unknown protein		Potri.011G070500 [exp]	7.54	0.9171
AT4G12560		CPR1, CPR30	CONSTITUTIVE EXPRESSER OF PR G...		Potri.011G121200 [exp]	10.48	0.9154
AT4G36670		AtPMT6, AtPLT6	polyol/monosaccharide transpor...		Potri.007G027900 [exp]	11.40	0.9426
AT1G73500		ATMKK9	MAP kinase kinase 9 (.1)		Potri.015G030700 [exp]	12.00	0.9179	Pt-MKK9.2

Compare expression of checked genes

Potri.011G061700 coexpression network

*The number of genes in the network is adjusted within 50 genes.
*Gene name represents symbol(s) of closest Arabidopsis gene if symbol(s) for the gene itself doesn't exist.
*Circle diameter represents the number of connection with other genes within this network.
*Color for gene name represents subnetwork based on the result of network clustering.